Production of Avilamycin A is regulated by AviC1 and AviC2, two transcriptional activators (2024)

Streptomycetes are typical soil-dwelling bacteria with intricate morphological and biochemical differentiation of colonies, resulting in onset of secondary metabolite production. Compounds produced during these stages of differentiation comprise nearly two-thirds of bioactive molecules synthesized by microorganisms, including antibiotics, antitumor agents and immunosuppressants.^{1, 2} The biosynthesis of antibiotics and other secondary metabolites is controlled by interactions of both global and pathway-specific regulators. However, in all cases, the influence of the environment is reflected by the activity of pathway-specific regulatory genes, which are located within a biosynthetic gene cluster and which control the expression of biosynthetic genes.³ On account of high structural and functional similarity, such regulators were grouped into two families, namely Streptomyces antibiotics regulatory proteins (SARP), mostly found within the aromatic polyketides clusters, and large ATP-binding regulators of LuxR family (LAL), controlling the production of macrolides and glycopeptides.^{4, 5, 6} Recent efforts in cloning and characterization of biosynthetic gene clusters for new groups of secondary metabolites revealed novel classes of transcriptional factors that differ from typical SARPs or LAL representatives.^{7, 8}

Avilamycins are secondary metabolites produced by Streptomyces viridochromogenes Tu57. They are active against Gram-positive bacteria. It is known that avilamycins bind to the 23S rRNA in the region proximal to the channel, where tRNA enters the A-site and blocks the protein synthesis.⁹ Avilamycin resistance is mediated by 23S rRNA methylation and active avilamycin transport.¹⁰

AviC1 consists of 206 amino acid (aa) residues. The C-terminal region of the putative aviC1 product is similar to response regulators, which contain a LuxR-type DNA-binding domain.¹⁴ Examples are CitB from Frankia sp. EAN1pec (53% identical aa) and NarQ, a nitrate/nitrite response regulator from Escherichia coli (43% identical aa).¹⁵ All these proteins possess common CheY-like N-terminal sensor domains that undergo phosphorylation by protein kinases and C-terminal LuxR-type Helix-Turn-Helix (HTH) DNA-binding domains.¹⁴ However, the AviC1 N terminus does not resemble CheY-like signal receiver domains, supposing that AviC1 responds to some other signals than phosphorylation.

The product of aviC2 consists of 192 aa residues. The C-terminal region of AviC2 exhibits similarity to proteins involved in the control of nystatin production in S. noursei (NysRIV, 56% identical aa)⁷ and pimaricin production in S. natalensis (PimM, 53% identical aa).¹⁶ These proteins contain N-terminal PAS domains and sense internal and external signals, such as redox potential or light.¹⁷ The C-terminal part of these proteins represents a LuxR type of HTH DNA-binding motif, which is formed by two α-helixes (R145-E157 and R164-L174 in the case of AviC2). BLASTP search for hom*ologs of the N-terminus of AviC2 did not give any significant matches.

To investigate the function of aviC1 and aviC2 genes, respective mutants were generated. For this purpose, plasmids pSPaviC1X and pSPaviC2X, were obtained. For inactivation of aviC1, the entire gene and flanking DNA regions were amplified by PCR using cosmid F4 as template, and primers aviC1Nr.1 (TCGCCACCGAATTCGGGCTGGACC) and aviC1Nr.2 (ACGTCATCTAGATGATGGAGCGCTTC) (Figure 1). The 1.5 kb PCR fragment was cloned into the EcoRI and XbaI sites of pSP1. The resulting plasmid pSPaviC1 was restricted by SacI and treated with T4 DNA polymerase. After ligation, pSPaviC1X was obtained. Sequencing confirmed an insertion of 4 bp in the aviC1-coding region. To inactivate aviC2, two PCR fragments containing parts of aviC2 were amplified using primers aviC2Nr.1 (TATGAGCGTGAGCTCCTTGCATGC), aviC2Nr.2 (GGTGAGGGTACCACCTGCATCG) and aviC2Nr.3 (ACTCCTTGGTACCCAACACTCGTTC), aviC2Nr.4 (CAGGGTCTAGATGGCGTGGACGG), respectively (Figure 1). PCR products were T/A cloned into pGEM vector (Promega, Mannheim, Germany) to yield pGEMaviC2l and pGEMaviC2r. Fragment aviC2r was restricted using KpnI and XbaI, and cloned into the respective sites of pGEMaviC2l. The resulting plasmid was digested using SacI and XbaI, and the fragment containing aviC2 with a deletion of 153 bp was subcloned into pSP1 to give pSPaviC2X.

For gene inactivation, S. viridochromogenes GW4 was used as a host. This strain lacks aviGW4, a methyltransferase gene involved in methylation of the orsellinic acid moiety of avilamycin A. Desmethyl-avilamycin derivatives are, namely, gavibamycin A1 (desmethyl-avilamycin A) and A3 (desmethyl-avilamycin C).¹⁸ pSPaviC1X and pSPaviC2X were introduced into S. viridochromogenes GW4 by protoplast transformation and selection for erythromycin resistant strains. Integration of the plasmids into the chromosome was shown by PCR analysis using primers aviC1F and aviC1R, and aviC2Nr.1 and aviC2Nr.4.

For the generation of S. viridochromogenes GW4-C1 and S. viridochromogenes GW4-C2 single-crossover mutants were screened for loss of resistance as a consequence of a double-crossover event. Insertion and deletions of the respective genes were confirmed by PCR and Southern hybridization. Analysis of secondary metabolites produced by S. viridochromogenes GW4-C1 and S. viridochromogenes GW4-C2 verified that both mutants did not produce either gavibamycin A derivatives or its intermediates, as analyzed by HPLC–MS.¹² For complementation and ‘overexpression’ experiments, aviC1 and aviC2 genes were PCR amplified using primers aviC1F (AACGCGTCAATTGAGCCACTGTCAC), aviC1R (CTGTACGTCTAGACGCGGTACACC) and aviC2F (ACGCCACGAATTCGCAGGCGTCGAGGA) aviC2R (GATGCACCTCTAGAAATCCGGCATCC), respectively (Figure 1). PCR products were cloned behind the P_ErmE promoter into the MunI and XbaI sites of pSET-1cerm. The resulting plasmids were named pSETerm-aviC1 and pSETerm-aviC2. For simultaneous expression of aviC1 and aviC2, plasmid pSETerm-C1C2 was constructed. A 1.7-kb fragment containing both genes was amplified using primers, aviC1F and aviC2R, and using cosmid F4 as a template. Introduction of pSETerm-aviC1 and pSETerm-aviC2 into S. viridochromogenes GW4-C1 and S. viridochromogenes GW4-C2, respectively, restored production of gavibamycin derivatives, indicating that the mutations did not have any polar effect on other genes of the cluster. On the basis of the results obtained, we suppose that both aviC1 and aviC2 gene products are positively controlling avilamycin production.

To establish the hierarchy of both regulatory proteins, cross-complementation experiments were performed. However neither aviC1 in S. viridochromogenes GW-C2 nor aviC2 in S. viridochromogenes GW-C1 were able to restore antibiotic production. The absence of cross-complementation between aviC1 and aviC2 suggests that both genes are acting at the same level of regulation.

To prove that AviC1 and AviC2 act as transcriptional regulators of structural avilamycin biosynthesis genes, reverse transcriptase (RT)-PCR was performed. Total RNA of S. viridochromogenes GW4, S. viridochromogenes GW4-C1 and S. viridochromogenes GW4-C2 were isolated using the hot-phenol extraction method.²⁰ RT-PCR was performed using the ImProm II Reverse Transcription System (Promega). Total RNA was extracted from the mycelia after 72 h of culture growth that coincides with the active phase of antibiotic production by the wild-type strain. We performed the transcription analysis of aviM, encoding a polyketide synthase type I (primers avMF (CTGCACCTACGACTATGGC) and avMR (CAGCAGCTTGATGACCAGC)), aviD encoding a dTDP glucose synthetase (primers avDF (ATTACGCATACCTCGGCCAA) and avDR (CTTCCAGTACCGGTCGATC)), aviGT3 encoding a glycosyltransferase (primers avGT3F (TCTGCTACGTCGACAACGAC) and avGT3R (GTGAAGAGGTAGTAGTAGCG)), aviC1 (primers avC1F (ATGGTCGGATCCCTCTGCA) and avC1R (CATGCAAGGACCACACGCT)), aviC2 (primers avC2F (TCAATTGACGCGTTCCTGCA) and avC2R1 (ATGATCGTGAAGTCCGGTCA)) and resistance gene aviRa encoding a rRNA methyltransferase (primers avRaF (GCGGATCGACAGTTCCGAT) and avRaR (AGATAGGAGGGCTTGCCGA)) (Figure 1). Primers specific to the 16S rRNA of S. coelicolor (rrnAF (CACATGCAAGTCGAACGATG) and rrnAR (GCTGCTGGCACGTAGTTAG)) were used as positive control. Samples were analyzed by 2% agarose gel electrophoresis, scanned and band density was measured using ImageJ 1.34s software (NIH, Bethesda, MD, USA).

In S. viridochromogenes GW4, both regulatory genes as well as biosynthetic and resistance genes were actively transcribed (Figure 2b). The transcription of aviM seemed to be much weaker than the activity of other structural genes, which might be explained either by the instability of the long aviM transcripts or by a low level of the aviM promoter activity. The latter has been described for PKSI-encoding genes from the nystatin biosynthesis gene cluster of S. norsei.⁷

In the case of S. viridochromogenes GW4-C1, no PCR fragment was obtained for aviM, aviGT3 and aviC2, whereas very tiny fragments were obtained for aviD, aviRa and aviC1 (Figure 2c). In the case of S. viridochromogenes GW4-C2, no PCR fragment was obtained for aviM, aviRa, aviGT3 and aviC2, whereas very tiny fragments were obtained for aviD and aviC1 (Figure 2d).

On the basis of the obtained results, we suggest that both aviC1 and aviC2 gene products are positively controlling avilamycin production at the level of transcription of structural genes. Surprisingly, in both mutants, transcripts of aviC1 were detectable at a very low level, but transcripts of aviC2 were not. This might indicate that AviC1 can control aviC2 expression and that AviC2 acts as autoregulator influencing its own gene transcription.

In conclusion, we have studied two novel regulatory genes controlling avilamycin production in S. viridochromogenes Tu57 that differ from the well-characterized SARP and LAL families of antibiotic biosynthesis regulators.